Review




Structured Review

Sangon Biotech brd2 sirna
Brd2 Sirna, supplied by Sangon Biotech, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/brd2+sirna/pm41773861-78-0-12?v=Sangon+Biotech
Average 86 stars, based on 1 article reviews
brd2 sirna - by Bioz Stars, 2026-07
86/100 stars

Images



Similar Products

86
Sangon Biotech brd2 sirna
Brd2 Sirna, supplied by Sangon Biotech, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/brd2+sirna/pm41773861-78-0-12?v=Sangon+Biotech
Average 86 stars, based on 1 article reviews
brd2 sirna - by Bioz Stars, 2026-07
86/100 stars
  Buy from Supplier

90
Thermo Fisher sirna targeting brd2 sibrd2
Sirna Targeting Brd2 Sibrd2, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/brd2+sirna/10__1016_slash_j__xjidi__2025__100355-173-15-51?v=Thermo+Fisher
Average 90 stars, based on 1 article reviews
sirna targeting brd2 sibrd2 - by Bioz Stars, 2026-07
90/100 stars
  Buy from Supplier

90
Shanghai GenePharma sirnas targeting brd4, brd2, egr1, e2f1–3 and the septins
Sirnas Targeting Brd4, Brd2, Egr1, E2f1–3 And The Septins, supplied by Shanghai GenePharma, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/brd2+sirna/pm39209080-60-11-15?v=Shanghai+GenePharma
Average 90 stars, based on 1 article reviews
sirnas targeting brd4, brd2, egr1, e2f1–3 and the septins - by Bioz Stars, 2026-07
90/100 stars
  Buy from Supplier

90
Shanghai GenePharma specific small interfering rna (sirna) brd2
<t>BRD2</t> was proved to be a target of miR-143. A: Tagetscan predicted the binding sequences between mIR-143 and BRD2, and 3’-UTR of BRD2 mRNA was mutated from UGAUGUCA to AGUAGAG in SRA01/04 cells; B: Luciferase reporter gene assay was performed to verify miR-143 direct binding to BRD2; C: The mRNA level of BRD2 after transfecting miR-143 inhibitor; D: The protein level of BRD2 after transfecting miR-143 inhibitor. NC: normal control; WT: wild type. *P<0.05, **P<0.01.
Specific Small Interfering Rna (Sirna) Brd2, supplied by Shanghai GenePharma, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/brd2+sirna/pmc10918123-66-11-2?v=Shanghai+GenePharma
Average 90 stars, based on 1 article reviews
specific small interfering rna (sirna) brd2 - by Bioz Stars, 2026-07
90/100 stars
  Buy from Supplier

90
Thermo Fisher silencer® select sirnas against brd2, brd3, brd4 and silencer negative control sirna
<t>BRD2</t> was proved to be a target of miR-143. A: Tagetscan predicted the binding sequences between mIR-143 and BRD2, and 3’-UTR of BRD2 mRNA was mutated from UGAUGUCA to AGUAGAG in SRA01/04 cells; B: Luciferase reporter gene assay was performed to verify miR-143 direct binding to BRD2; C: The mRNA level of BRD2 after transfecting miR-143 inhibitor; D: The protein level of BRD2 after transfecting miR-143 inhibitor. NC: normal control; WT: wild type. *P<0.05, **P<0.01.
Silencer® Select Sirnas Against Brd2, Brd3, Brd4 And Silencer Negative Control Sirna, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/brd2+sirna/pm37296612-63-6-15?v=Thermo+Fisher
Average 90 stars, based on 1 article reviews
silencer® select sirnas against brd2, brd3, brd4 and silencer negative control sirna - by Bioz Stars, 2026-07
90/100 stars
  Buy from Supplier

90
Thermo Fisher silencer select sirnas against brd2, brd3, brd4 and silencer negative control sirna
Targeting BET proteins decreases HYAL1 expression. ( A ) PDAC cell lines Panc1 and AsPC1 and the immortalized stellate (Stl) cell line were treated with DMSO or JQ1 for 24 h, and the effect on HYAL1 mRNA expression was determined by qRT-PCR. HYAL1 protein concentration in cell culture media was measured by HYAL1 ELISA after 72 h of treatment with JQ1 or control (DMSO). Mean ± SD. ( B ) Panc1, AsPC1 and Stl cell lines were transfected with control siRNA or with a combination of siRNAs against BRD2, <t>BRD3,</t> and BRD4 (siB2+3+4). The efficiency of BRD2, BRD3, and BRD4 knockdown was determined at the mRNA level after 48 h of transfection by qRT-PCR (the mean ± SD) and at the protein level by western blotting after 72 h of transfection. ( C ) The effect of siB2+3+4 on HYAL1 expression was determined by qRT-PCR and by ELISA after 96 h of transfection. Mean ± SD. The western blot results are representative of three independent experiments. The qRT-PCR and ELISA results are the mean of three independent experiments. Statistical analysis of ELISA results was done by Student’s t -test, * p < 0.05; ** p < 0.01.
Silencer Select Sirnas Against Brd2, Brd3, Brd4 And Silencer Negative Control Sirna, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/brd2+sirna/pmc10253193-55-6-16?v=Thermo+Fisher
Average 90 stars, based on 1 article reviews
silencer select sirnas against brd2, brd3, brd4 and silencer negative control sirna - by Bioz Stars, 2026-07
90/100 stars
  Buy from Supplier

90
Millipore brd4- brd2-specific sirnas
(A) FaDu parental and CTXR cells were transfected with non-targeting control <t>(NTC),</t> <t>BRD4</t> and BRD2 <t>siRNAs</t> for 72 hours. Protein expression levels of BRD4, BRD2, PD-L1 and beta-actin was determined by immunoblotting. Densitometric ratios of PD-L1 bands to Actin bands were determined by ImageJ and represented as a fold change to Parental NTC lane. (B) PE/CA-PJ49 and FaDu parental and CTXR clones were transiently transfected with siRNAs as described in (A). Flow cytometric analysis of PD-L1-positive cells was determined and (C) mRNA levels of CD274 was evaluated by qRT-PCR (n=3)* p < 0.05 ( Student’s t-test). (D) Chromatin immunoprecipitation analysis of IgG, BRD2, BRD3 and BRD4 proteins enriched on the CD274 promoter was assessed in the FaDu parental and CTXR#3 clone (n=2). * p < 0.05 ( Student’s t-test). Error bars represent SEM.
Brd4 Brd2 Specific Sirnas, supplied by Millipore, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/brd2+sirna/pmc08664160-99-3-7?v=Millipore
Average 90 stars, based on 1 article reviews
brd4- brd2-specific sirnas - by Bioz Stars, 2026-07
90/100 stars
  Buy from Supplier

90
Shanghai GenePharma brd2 sirna
(A) FaDu parental and CTXR cells were transfected with non-targeting control <t>(NTC),</t> <t>BRD4</t> and BRD2 <t>siRNAs</t> for 72 hours. Protein expression levels of BRD4, BRD2, PD-L1 and beta-actin was determined by immunoblotting. Densitometric ratios of PD-L1 bands to Actin bands were determined by ImageJ and represented as a fold change to Parental NTC lane. (B) PE/CA-PJ49 and FaDu parental and CTXR clones were transiently transfected with siRNAs as described in (A). Flow cytometric analysis of PD-L1-positive cells was determined and (C) mRNA levels of CD274 was evaluated by qRT-PCR (n=3)* p < 0.05 ( Student’s t-test). (D) Chromatin immunoprecipitation analysis of IgG, BRD2, BRD3 and BRD4 proteins enriched on the CD274 promoter was assessed in the FaDu parental and CTXR#3 clone (n=2). * p < 0.05 ( Student’s t-test). Error bars represent SEM.
Brd2 Sirna, supplied by Shanghai GenePharma, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/brd2+sirna/pm32603665-115-6-15?v=Shanghai+GenePharma
Average 90 stars, based on 1 article reviews
brd2 sirna - by Bioz Stars, 2026-07
90/100 stars
  Buy from Supplier

86
Bioneer Corporation 2010 n a 50 uguacaucgagaaauauacuu 30 accutargettm negative control sirna bioneer n a recombinant dna gfp brd2 plasmid addgene addgene
(A) FaDu parental and CTXR cells were transfected with non-targeting control <t>(NTC),</t> <t>BRD4</t> and BRD2 <t>siRNAs</t> for 72 hours. Protein expression levels of BRD4, BRD2, PD-L1 and beta-actin was determined by immunoblotting. Densitometric ratios of PD-L1 bands to Actin bands were determined by ImageJ and represented as a fold change to Parental NTC lane. (B) PE/CA-PJ49 and FaDu parental and CTXR clones were transiently transfected with siRNAs as described in (A). Flow cytometric analysis of PD-L1-positive cells was determined and (C) mRNA levels of CD274 was evaluated by qRT-PCR (n=3)* p < 0.05 ( Student’s t-test). (D) Chromatin immunoprecipitation analysis of IgG, BRD2, BRD3 and BRD4 proteins enriched on the CD274 promoter was assessed in the FaDu parental and CTXR#3 clone (n=2). * p < 0.05 ( Student’s t-test). Error bars represent SEM.
2010 N A 50 Uguacaucgagaaauauacuu 30 Accutargettm Negative Control Sirna Bioneer N A Recombinant Dna Gfp Brd2 Plasmid Addgene Addgene, supplied by Bioneer Corporation, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/brd2+sirna/pm31875566-423-66-75?v=Bioneer+Corporation
Average 86 stars, based on 1 article reviews
2010 n a 50 uguacaucgagaaauauacuu 30 accutargettm negative control sirna bioneer n a recombinant dna gfp brd2 plasmid addgene addgene - by Bioz Stars, 2026-07
86/100 stars
  Buy from Supplier

Image Search Results


BRD2 was proved to be a target of miR-143. A: Tagetscan predicted the binding sequences between mIR-143 and BRD2, and 3’-UTR of BRD2 mRNA was mutated from UGAUGUCA to AGUAGAG in SRA01/04 cells; B: Luciferase reporter gene assay was performed to verify miR-143 direct binding to BRD2; C: The mRNA level of BRD2 after transfecting miR-143 inhibitor; D: The protein level of BRD2 after transfecting miR-143 inhibitor. NC: normal control; WT: wild type. *P<0.05, **P<0.01.

Journal: American Journal of Translational Research

Article Title: miR-143 promotes cell proliferation, invasion and migration via directly binding to BRD2 in lens epithelial cells

doi:

Figure Lengend Snippet: BRD2 was proved to be a target of miR-143. A: Tagetscan predicted the binding sequences between mIR-143 and BRD2, and 3’-UTR of BRD2 mRNA was mutated from UGAUGUCA to AGUAGAG in SRA01/04 cells; B: Luciferase reporter gene assay was performed to verify miR-143 direct binding to BRD2; C: The mRNA level of BRD2 after transfecting miR-143 inhibitor; D: The protein level of BRD2 after transfecting miR-143 inhibitor. NC: normal control; WT: wild type. *P<0.05, **P<0.01.

Article Snippet: Cell transfection GenePharma Technology (Shanghai, China) synthesized and commercially obtained specific small interfering RNA (siRNA) BRD2, scramble oligonucleotides, miR-143 mimic, and miR-143 inhibitor.

Techniques: Binding Assay, Luciferase, Reporter Gene Assay, Control

Silencing of BRD2 partially reversed the functions of miR-143 inhibitor on proliferation and metastasis. A: The mRNA and protein levels of BRD2 were detected after co-transfection of miR-143 inhibitor and si-BRD2; B: Co-transfection of miR-143 inhibitor and si-BRD2 reversed the effect of miR-143 inhibitor on cell proliferation; C and D: Knockdown of BRD2 reversed the effects of miR-143 inhibitor on cell invasion (200×) and migration (100×). NC: normal control. *P<0.05, **P<0.01, ***P<0.001.

Journal: American Journal of Translational Research

Article Title: miR-143 promotes cell proliferation, invasion and migration via directly binding to BRD2 in lens epithelial cells

doi:

Figure Lengend Snippet: Silencing of BRD2 partially reversed the functions of miR-143 inhibitor on proliferation and metastasis. A: The mRNA and protein levels of BRD2 were detected after co-transfection of miR-143 inhibitor and si-BRD2; B: Co-transfection of miR-143 inhibitor and si-BRD2 reversed the effect of miR-143 inhibitor on cell proliferation; C and D: Knockdown of BRD2 reversed the effects of miR-143 inhibitor on cell invasion (200×) and migration (100×). NC: normal control. *P<0.05, **P<0.01, ***P<0.001.

Article Snippet: Cell transfection GenePharma Technology (Shanghai, China) synthesized and commercially obtained specific small interfering RNA (siRNA) BRD2, scramble oligonucleotides, miR-143 mimic, and miR-143 inhibitor.

Techniques: Cotransfection, Knockdown, Migration, Control

Targeting BET proteins decreases HYAL1 expression. ( A ) PDAC cell lines Panc1 and AsPC1 and the immortalized stellate (Stl) cell line were treated with DMSO or JQ1 for 24 h, and the effect on HYAL1 mRNA expression was determined by qRT-PCR. HYAL1 protein concentration in cell culture media was measured by HYAL1 ELISA after 72 h of treatment with JQ1 or control (DMSO). Mean ± SD. ( B ) Panc1, AsPC1 and Stl cell lines were transfected with control siRNA or with a combination of siRNAs against BRD2, BRD3, and BRD4 (siB2+3+4). The efficiency of BRD2, BRD3, and BRD4 knockdown was determined at the mRNA level after 48 h of transfection by qRT-PCR (the mean ± SD) and at the protein level by western blotting after 72 h of transfection. ( C ) The effect of siB2+3+4 on HYAL1 expression was determined by qRT-PCR and by ELISA after 96 h of transfection. Mean ± SD. The western blot results are representative of three independent experiments. The qRT-PCR and ELISA results are the mean of three independent experiments. Statistical analysis of ELISA results was done by Student’s t -test, * p < 0.05; ** p < 0.01.

Journal: Cells

Article Title: Targeting BET Proteins Decreases Hyaluronidase-1 in Pancreatic Cancer

doi: 10.3390/cells12111490

Figure Lengend Snippet: Targeting BET proteins decreases HYAL1 expression. ( A ) PDAC cell lines Panc1 and AsPC1 and the immortalized stellate (Stl) cell line were treated with DMSO or JQ1 for 24 h, and the effect on HYAL1 mRNA expression was determined by qRT-PCR. HYAL1 protein concentration in cell culture media was measured by HYAL1 ELISA after 72 h of treatment with JQ1 or control (DMSO). Mean ± SD. ( B ) Panc1, AsPC1 and Stl cell lines were transfected with control siRNA or with a combination of siRNAs against BRD2, BRD3, and BRD4 (siB2+3+4). The efficiency of BRD2, BRD3, and BRD4 knockdown was determined at the mRNA level after 48 h of transfection by qRT-PCR (the mean ± SD) and at the protein level by western blotting after 72 h of transfection. ( C ) The effect of siB2+3+4 on HYAL1 expression was determined by qRT-PCR and by ELISA after 96 h of transfection. Mean ± SD. The western blot results are representative of three independent experiments. The qRT-PCR and ELISA results are the mean of three independent experiments. Statistical analysis of ELISA results was done by Student’s t -test, * p < 0.05; ** p < 0.01.

Article Snippet: Silencer ® Select siRNAs against BRD2, BRD3, BRD4 and Silencer Negative Control siRNA were purchased from Ambion, Thermo Fisher Scientific.

Techniques: Expressing, Quantitative RT-PCR, Protein Concentration, Cell Culture, Enzyme-linked Immunosorbent Assay, Control, Transfection, Knockdown, Western Blot

Regulation of HYAL1 expression by BRD2, BRD3 and BRD4. ( A – C ) Panc1 ( A ), AsPC1 ( B ), and stellate (Stl, C ) cells were transfected with control siRNA or individual siRNAs against BRD2 (siB2), BRD3 (siB3), and BRD4 (siB4). The efficiency of BRD2, BRD3, and BRD4 knockdown was determined at the protein level by Western blotting after 72 h of transfection and the effect on HYAL1 protein concentration was determined with ELISA after 96 h of transfection. Mean ± SD. ( D ) AsPC1 cell line was with the BET inhibitor JQ1 (1 μM) overnight. The cells were subjected to ChIP analysis using an anti-BRD2 antibody, and an isotype-matched IgG was used as a negative control. The association with the HYAL1 gene promoter was quantified by qPCR and 2% agarose gel electrophoresis. The qPCR results are the mean of two independent experiments. Mean ± SD. The western blot results are representative of three independent experiments, and ELISA results are the mean of three independent experiments. Statistical analysis of ELISA results was done by Student’s t -test, ns p > 0.05; * p < 0.05; ** p < 0.01. NC, no template control.

Journal: Cells

Article Title: Targeting BET Proteins Decreases Hyaluronidase-1 in Pancreatic Cancer

doi: 10.3390/cells12111490

Figure Lengend Snippet: Regulation of HYAL1 expression by BRD2, BRD3 and BRD4. ( A – C ) Panc1 ( A ), AsPC1 ( B ), and stellate (Stl, C ) cells were transfected with control siRNA or individual siRNAs against BRD2 (siB2), BRD3 (siB3), and BRD4 (siB4). The efficiency of BRD2, BRD3, and BRD4 knockdown was determined at the protein level by Western blotting after 72 h of transfection and the effect on HYAL1 protein concentration was determined with ELISA after 96 h of transfection. Mean ± SD. ( D ) AsPC1 cell line was with the BET inhibitor JQ1 (1 μM) overnight. The cells were subjected to ChIP analysis using an anti-BRD2 antibody, and an isotype-matched IgG was used as a negative control. The association with the HYAL1 gene promoter was quantified by qPCR and 2% agarose gel electrophoresis. The qPCR results are the mean of two independent experiments. Mean ± SD. The western blot results are representative of three independent experiments, and ELISA results are the mean of three independent experiments. Statistical analysis of ELISA results was done by Student’s t -test, ns p > 0.05; * p < 0.05; ** p < 0.01. NC, no template control.

Article Snippet: Silencer ® Select siRNAs against BRD2, BRD3, BRD4 and Silencer Negative Control siRNA were purchased from Ambion, Thermo Fisher Scientific.

Techniques: Expressing, Transfection, Control, Knockdown, Western Blot, Protein Concentration, Enzyme-linked Immunosorbent Assay, Negative Control, Agarose Gel Electrophoresis

(A) FaDu parental and CTXR cells were transfected with non-targeting control (NTC), BRD4 and BRD2 siRNAs for 72 hours. Protein expression levels of BRD4, BRD2, PD-L1 and beta-actin was determined by immunoblotting. Densitometric ratios of PD-L1 bands to Actin bands were determined by ImageJ and represented as a fold change to Parental NTC lane. (B) PE/CA-PJ49 and FaDu parental and CTXR clones were transiently transfected with siRNAs as described in (A). Flow cytometric analysis of PD-L1-positive cells was determined and (C) mRNA levels of CD274 was evaluated by qRT-PCR (n=3)* p < 0.05 ( Student’s t-test). (D) Chromatin immunoprecipitation analysis of IgG, BRD2, BRD3 and BRD4 proteins enriched on the CD274 promoter was assessed in the FaDu parental and CTXR#3 clone (n=2). * p < 0.05 ( Student’s t-test). Error bars represent SEM.

Journal: Head & neck

Article Title: PD-L1 is upregulated via BRD2 in head and neck squamous cell carcinoma models of acquired cetuximab resistance

doi: 10.1002/hed.26827

Figure Lengend Snippet: (A) FaDu parental and CTXR cells were transfected with non-targeting control (NTC), BRD4 and BRD2 siRNAs for 72 hours. Protein expression levels of BRD4, BRD2, PD-L1 and beta-actin was determined by immunoblotting. Densitometric ratios of PD-L1 bands to Actin bands were determined by ImageJ and represented as a fold change to Parental NTC lane. (B) PE/CA-PJ49 and FaDu parental and CTXR clones were transiently transfected with siRNAs as described in (A). Flow cytometric analysis of PD-L1-positive cells was determined and (C) mRNA levels of CD274 was evaluated by qRT-PCR (n=3)* p < 0.05 ( Student’s t-test). (D) Chromatin immunoprecipitation analysis of IgG, BRD2, BRD3 and BRD4 proteins enriched on the CD274 promoter was assessed in the FaDu parental and CTXR#3 clone (n=2). * p < 0.05 ( Student’s t-test). Error bars represent SEM.

Article Snippet: BRD4- and BRD2-specific siRNAs were ordered through Sigma-Aldrich.

Techniques: Transfection, Expressing, Western Blot, Clone Assay, Quantitative RT-PCR, Chromatin Immunoprecipitation

(A) PE/CA-PJ49 cells were exposed to a high concentration of cisplatin and the resistant clones were continually treated with cisplatin. Resistance to cisplatin in three different clones (#1, #3 and #4) was evaluated. Parental and CISR clones were treated with 2uM of cisplatin for 96 hours. Cell viability was determined by crystal violet assay (n=3) *p<0.05 (Student’s t-test); Error bars represent SEM. (B) PE/CA-PJ49 PAR and CISR clones were transiently transfected with NTC, BRD4 and BRD2 siRNAs for 72 hours. Lysates were evaluated for BRD2, BRD4, PD-L1 and beta-Actin. Blots of short and long exposures for BRD2, BRD4 and PD-L1 are illustrated. Densitometric analysis of PD-L1 bands to Actin bands were determined by Image J and represented as a fold change to Parental NTC lane.

Journal: Head & neck

Article Title: PD-L1 is upregulated via BRD2 in head and neck squamous cell carcinoma models of acquired cetuximab resistance

doi: 10.1002/hed.26827

Figure Lengend Snippet: (A) PE/CA-PJ49 cells were exposed to a high concentration of cisplatin and the resistant clones were continually treated with cisplatin. Resistance to cisplatin in three different clones (#1, #3 and #4) was evaluated. Parental and CISR clones were treated with 2uM of cisplatin for 96 hours. Cell viability was determined by crystal violet assay (n=3) *p<0.05 (Student’s t-test); Error bars represent SEM. (B) PE/CA-PJ49 PAR and CISR clones were transiently transfected with NTC, BRD4 and BRD2 siRNAs for 72 hours. Lysates were evaluated for BRD2, BRD4, PD-L1 and beta-Actin. Blots of short and long exposures for BRD2, BRD4 and PD-L1 are illustrated. Densitometric analysis of PD-L1 bands to Actin bands were determined by Image J and represented as a fold change to Parental NTC lane.

Article Snippet: BRD4- and BRD2-specific siRNAs were ordered through Sigma-Aldrich.

Techniques: Concentration Assay, Clone Assay, Crystal Violet Assay, Transfection